FLEXGene : Clone Info


Clone ID: 227876 FLEX Clone ID: FLH227876.01L
Clone Type: Expression Master Clone ID: 87341
Clone Status: SUCCESSFUL Reference FLEX Sequence ID: 20353
Species: Homo sapiens Version: FUSION
 
 
 
Cloning Strategy: CREATOR EXPRESSION - pLP-EGFP-C1
Vector: pLP-EGFP-C1
5' Linker Name: 5p Creator linker 5' Linker Sequence: 5p GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACC(atg-goi)
3' Linker Name 3p Creator linker 3' Linker Sequence: 5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC
 
Result Against Expected Sequence: Match Expected Sequence:
Alternative Genbank Match: Result Against Genbank Sequence:
Match Genbank Sequence:

Sequence: