FLEXGene : Clone Info


Clone ID: 206635 FLEX Clone ID:
Clone Type: Master Master Clone ID: 179381
Clone Status: UNSEQUENCED Reference FLEX Sequence ID: 60130
Species: Yersinia pseudotuberculosis Version: CLOSED
 
 
 
Cloning Strategy: GATEWAY - pDONR221
Vector: pDONR221
5' Linker Name: 5p pDONR221 linker 5' Linker Sequence: 5p GTACAAAAAAGCAGGCTCCACC(atg-goi)
3' Linker Name 3p pDONR221 linker 3' Linker Sequence: 5p (goi-stop)GACCCAGCTTTCTTGTAC
 
Result Against Expected Sequence: Match Expected Sequence:
Alternative Genbank Match: Result Against Genbank Sequence:
Match Genbank Sequence:

Sequence: