FLEXGene : Clone Info


Clone ID: 13486 FLEX Clone ID: FLH013486.01X
Clone Type: Master Master Clone ID: 27685
Clone Status: SEQUENCE VERIFIED Reference FLEX Sequence ID: 25819
Species: Homo sapiens Version: CLOSED
 
 
 
Cloning Strategy: CREATOR
Vector: pDNR-Dual
5' Linker Name: 5p Creator linker 5' Linker Sequence: 5p GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACC(atg-goi)
3' Linker Name 3p Creator linker 3' Linker Sequence: 5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC
 
Result Against Expected Sequence: Match Expected Sequence: Perfect Match
Alternative Genbank Match: Result Against Genbank Sequence: 376:OK; 377:OK;
Match Genbank Sequence: Perfect Match

Sequence:

GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACCATGGCCC GCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCC TGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCT GCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGA AGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGA AAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACA GTGACAAATCCAACTAGGGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC