FLEXGene : Clone Info


Clone ID: 117185 FLEX Clone ID: FLH117185.01L
Clone Type: Master Master Clone ID: 93031
Clone Status: SEQUENCE VERIFIED Reference FLEX Sequence ID: 28980
Species: Homo sapiens Version: FUSION
 
 
 
Cloning Strategy: CREATOR
Vector: pDNR-Dual
5' Linker Name: 5p Creator linker 5' Linker Sequence: 5p GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTCGACACC(atg-goi)
3' Linker Name 3p Creator linker 3' Linker Sequence: 5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC
 
Result Against Expected Sequence: Match Expected Sequence:
Alternative Genbank Match: Result Against Genbank Sequence:
Match Genbank Sequence:

Sequence:

ATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCG GTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCT CTGACCACTCTCCAGCACCAGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCACC ATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCT CTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTAT GGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATG GTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGC CAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAAC GACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTG ACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCTTCCCT GCCCTCTGCCAGCTGGGCAAATACACTACGAACAACAGCTCAGAACAACGTGTCTCTCTG GACATTGACCTCTGGGACAAGTTCAGTGAACTCTCCACCAAGTGCATCATTAAGACTGTG GAGTTCGCCAAGCAGCTGCCCGGCTTCACCACCCTCACCATCGCCGACCAGATCACCCTC CTCAAGGCTGCCTGCCTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAG CAGGACACCATGACCTTCTCGGACGGGCTGACCCTGAACCGGACCCAGATGCACAACGCT GGCTTCGGCCCCCTCACCGACCTGGTCTTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAG ATGGATGATGCGGAGACGGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCCAG GACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGGCGCTAAAG GTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGCTAATGAAG ATTACTGACCTGCGAAGCATCAGCGCCAAGGGGGCTGAGCGGGTGATCACGCTGAAGATG GAGATCCCGGGCTCCATGCCGCCTCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTG GACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCG CCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCAC TCCCCGTGA