FLEXGene : Clone Info


Clone ID: 1003 FLEX Clone ID: FLH001003.01X
Clone Type: Master Master Clone ID: 561
Clone Status: SEQUENCE VERIFIED Reference FLEX Sequence ID: 4068
Species: Saccharomyces cerevisiae Version: CLOSED
 
 
 
Cloning Strategy: YEAST GATEWAY
Vector: pDONR201
5' Linker Name: 5p Yeast linker 5' Linker Sequence: 5p TCCAGCTGACCACC(atg-goi)
3' Linker Name 3p Yeast linker 3' Linker Sequence: 5p (goi-stop)CATGGCAATTCCCGGGGAT
 
Result Against Expected Sequence: %a377g,Y126C Match Expected Sequence:
Alternative Genbank Match: Result Against Genbank Sequence:
Match Genbank Sequence:

Sequence:

CCAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAAT GCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTTCCAGCTGACCACCATGTCAA CCAAACCAGAGAAGCCAATATGGATGTCACAAGAAGACTATGACCGTCAGTACGGCTCAA TTACTGGTGATGAATCGTCCACAGTCTCAAAAAAAGACTCCAAAGTTACTGCCAATGCGC CTGGTGATGGTAATGGATCATTACCAGTTTTGCAAAGCAGCTCTATCCTTACTTCTAAGG TGTCTGATCTACCCATTGAGGCAGAATCCGGGTTTAAAATCCAAAAGAGAAGACATGAAA GGTATGATCAAGAGGAAAGATTACGCAAACAGCGTGCTCAAAAATTGAGAGAAGAGCAAC TAAAGAGACATGAAATAGAGATGACTGCAAATAGATCCATAAATGTTGACCAGATTGTCC GAGAGCACTGTAATGAACGTACAATAATCGCCAATCGCGCTAAGAGGAATCTATCGCCTA TTATTAAGCTTCGTAATTTTAACAATGCGATTAAGTATATGTTAATTGACAAATATACAA AACCTGGAGATGTCGTTTTAGAACTCGGATGTGGCAAAGGTGGTGATTTAAGAAAATATG GTGCTGCAGGTATTTCACAGTTTATTGGTATTGACATTTCCAATGCCTCTATCCAAGAAG CTCATAAGAGATACCGGTCCATGAGAAATTTGGACTACCAAGTTGTGCTAATTACTGGGG ATTGCTTTGGCGAATCATTAGGTGTTGCAGTAGAGCCCTTCCCAGACTGTAGATTTCCGT GTGATATCGTTTCGACGCAATTTTGCTTGCATTATGCTTTTGAGACCGAAGAAAAAGCAA GGAGAGCTTTACTGAATGTCGCCAAATCACTCAAAATTGGTGGTCACTTTTTTGGCACGA TACCAGATTCAGAATTCATTCGTTATAAACTGAATAAATTTCCCAAAGAAGTGGAAAAGC CATCTTGGGGAAACTCCATTTATAAAGTGACATTTGAGAATAATTCATACCAAAAGAATG ATTATGAGTTCACATCGCCTTATGGTCAAATGTATACTTATTGGCTAGAAGATGCTATAG ATAATGTTCCTGAATATGTTGTGCCATTCGAAACCTTAAGAAGTTTGGCTGATGAATACG GTTTGGAACTAGTATCGCAAATGCCTTTTAATAAATTTTTTGTCCAAGAAATTCCCAAAT GGATTGAGAGGTTTTCGCCTAAAATGAGGGAAGGTTTACAAAGATCTGATGGTAGATATG GTGTTGAAGGGGATGAAAAGGAAGCGGCATCATATTTCTATACCATGTTTGCATTCCGTA AGGTAAAACAGTATATCGAACCGGAAAGCGTAAAGCCCAACTGACATGGCAATTCCCGGG GATACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTT GCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTCCATCCAGCGCAGCTTG